Sequence retrieval

Genome: Bacillus licheniformis DSM 13
Start position: 1099854
End position: 1099882
Length: 29

DNA sequence
>NC_006322, from 1099854 to 1099882 (29 bp); Bacillus licheniformis DSM 13 TAATAGTAGTAATAATAGTAGTAGTAGTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1099761-1099958	Sequence	BLi01099 ynzH protein YnzH (Protein is coded in complementary strand; from 1099958 to 1099761)