Sequence retrieval

Genome: Acinetobacter sp. ADP1
Start position: 154592
End position: 154628
Length: 37

DNA sequence
>NC_005966, from 154592 to 154628 (37 bp); Acinetobacter sp. ADP1 GCAATTTTCGTAATTTTCGTAATTTTCGTAATTTTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 152162-154642	Sequence	ACIAD0152 - hypothetical protein (Protein is coded in complementary strand; from 154642 to 152162)