Sequence retrieval

Genome: Acinetobacter sp. ADP1
Start position: 1851995
End position: 1852030
Length: 36

DNA sequence
>NC_005966, from 1851995 to 1852030 (36 bp); Acinetobacter sp. ADP1 ACCGTACTATTTGCCGTAGTATTTGCCGTAGTATTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1851833-1853137	Sequence	ACIAD1852 - hypothetical protein (Protein is coded in complementary strand; from 1853137 to 1851833)