Sequence retrieval

Genome: Acinetobacter sp. ADP1
Start position: 2775307
End position: 2775337
Length: 31

DNA sequence
>NC_005966, from 2775307 to 2775337 (31 bp); Acinetobacter sp. ADP1 CATACCGCCCATACCACCCATGCCGCCCATA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2775302-2776936	Sequence	ACIAD2838 groEL molecular chaperone GroEL (Protein is coded in complementary strand; from 2776936 to 2775302)