Sequence retrieval

Genome: Acinetobacter sp. ADP1
Start position: 908215
End position: 908240
Length: 26

DNA sequence
>NC_005966, from 908215 to 908240 (26 bp); Acinetobacter sp. ADP1 TTTTAGTTTTATTTTAAGTTTCAGTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 908094-908216	Sequence	ACIAD0925 - hypothetical protein (Protein is coded in complementary strand; from 908216 to 908094)