Sequence retrieval

Genome: Acinetobacter sp. ADP1
Start position: 1927134
End position: 1927159
Length: 26

DNA sequence
>NC_005966, from 1927134 to 1927159 (26 bp); Acinetobacter sp. ADP1 CATTCCATTTCGTTCCATCCCATTGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1927016-1928437	Sequence	ACIAD1938 - hypothetical protein (Protein is coded in complementary strand; from 1928437 to 1927016)