Sequence retrieval

Genome: Acinetobacter sp. ADP1
Start position: 225825
End position: 225849
Length: 25

DNA sequence
>NC_005966, from 225825 to 225849 (25 bp); Acinetobacter sp. ADP1 ATTTGTGATTTGAGATTTTTGATTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 225814-226608	Sequence	ACIAD0226 - lysozyme (Protein is coded in complementary strand; from 226608 to 225814)