Sequence retrieval

Genome: Acinetobacter sp. ADP1
Start position: 1854135
End position: 1854158
Length: 24

DNA sequence
>NC_005966, from 1854135 to 1854158 (24 bp); Acinetobacter sp. ADP1 GCACCACCACCAGCGCCAGCACCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1853415-1854824	Sequence	ACIAD1854 - hypothetical protein (Protein is coded in complementary strand; from 1854824 to 1853415)