Sequence retrieval

Genome: Acinetobacter sp. ADP1
Start position: 1576779
End position: 1576802
Length: 24

DNA sequence
>NC_005966, from 1576779 to 1576802 (24 bp); Acinetobacter sp. ADP1 TGTGATTCTGATGGTGATTGTAAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1576758-1577684	Sequence	ACIAD1584 srpH serine acetyltransferase (Protein is coded in complementary strand; from 1577684 to 1576758)