Sequence retrieval

Genome: Parachlamydia sp. UWE25
Start position: 2410762
End position: 2410807
Length: 46

DNA sequence
>NC_005861, from 2410762 to 2410807 (46 bp); Parachlamydia sp. UWE25 TCTCCTTTAAGAATTTCTTCATTGAGAATTTCTTTTTTAAGAGTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2410591-2411871	Sequence	pc2027 - hypothetical protein (Protein is coded in complementary strand; from 2411871 to 2410591)