Sequence retrieval

Genome: Parachlamydia sp. UWE25
Start position: 2135090
End position: 2135125
Length: 36

DNA sequence
>NC_005861, from 2135090 to 2135125 (36 bp); Parachlamydia sp. UWE25 CATCACAGTCAGAATCACAGTCAGAATCACAGTCAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2134357-2135349	Sequence	pc1778 - hypothetical protein (Protein is coded in complementary strand; from 2135349 to 2134357)