Sequence retrieval

Genome: Parachlamydia sp. UWE25
Start position: 1635810
End position: 1635845
Length: 36

DNA sequence
>NC_005861, from 1635810 to 1635845 (36 bp); Parachlamydia sp. UWE25 TTCAATTTCTAATTCAACTTTTAAATCATTTTCTAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1635004-1636236	Sequence	pc1365 - two-component sensor histidine kinase (Protein is coded in complementary strand; from 1636236 to 1635004)