Sequence retrieval

Genome: Parachlamydia sp. UWE25
Start position: 1433198
End position: 1433230
Length: 33

DNA sequence
>NC_005861, from 1433198 to 1433230 (33 bp); Parachlamydia sp. UWE25 TTTTAAAAAGATTTTAAACAGGTTCTAAGAAGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 1432859-1433215	Sequence	pc1200 - hypothetical protein
ORF... 1433201-1433911	Sequence	pc1201 - hypothetical protein (Protein is coded in complementary strand; from 1433911 to 1433201)