Sequence retrieval

Genome: Parachlamydia sp. UWE25
Start position: 1891356
End position: 1891387
Length: 32

DNA sequence
>NC_005861, from 1891356 to 1891387 (32 bp); Parachlamydia sp. UWE25 TCGTCATCATCATCATCATCGTCTTCGTCATC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1891281-1891670	Sequence	pc1575 - hypothetical protein (Protein is coded in complementary strand; from 1891670 to 1891281)