Sequence retrieval

Genome: Parachlamydia sp. UWE25
Start position: 580859
End position: 580888
Length: 30

DNA sequence
>NC_005861, from 580859 to 580888 (30 bp); Parachlamydia sp. UWE25 AATTTTTTTTATTTTTTTATGGTTTTTTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 580876-582192	Sequence	pc0452 - hypothetical protein (Protein is coded in complementary strand; from 582192 to 580876)