Sequence retrieval

Genome: Parachlamydia sp. UWE25
Start position: 2239425
End position: 2239454
Length: 30

DNA sequence
>NC_005861, from 2239425 to 2239454 (30 bp); Parachlamydia sp. UWE25 AAAAATATATAAAAATAAAAAAAGATGTAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2238592-2239479	Sequence	pc1878 - procollagen-lysine 5-dioxygenase (Protein is coded in complementary strand; from 2239479 to 2238592)