Sequence retrieval

Genome: Parachlamydia sp. UWE25
Start position: 2367295
End position: 2367318
Length: 24

DNA sequence
>NC_005861, from 2367295 to 2367318 (24 bp); Parachlamydia sp. UWE25 AGGAGGAGGGGGAGGAGCGGGAGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2366306-2367910	Sequence	pc1985 - hypothetical protein (Protein is coded in complementary strand; from 2367910 to 2366306)