Sequence retrieval

Genome: Parachlamydia sp. UWE25
Start position: 1851092
End position: 1851115
Length: 24

DNA sequence
>NC_005861, from 1851092 to 1851115 (24 bp); Parachlamydia sp. UWE25 TTTTGCTTTTGGCTTTGCTTTTAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1851015-1851410	Sequence	pc1545 hctA histone H1-like protein (Protein is coded in complementary strand; from 1851410 to 1851015)