Sequence retrieval

Genome: Bdellovibrio bacteriovorus HD100
Start position: 731616
End position: 731639
Length: 24

DNA sequence
>NC_005363, from 731616 to 731639 (24 bp); Bdellovibrio bacteriovorus HD100 GTGGATTTGGATGTGGGTATGGAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 731366-731815	Sequence	Bd0774 - hypothetical protein (Protein is coded in complementary strand; from 731815 to 731366)