Sequence retrieval

Genome: Bdellovibrio bacteriovorus HD100
Start position: 61369
End position: 61401
Length: 33

DNA sequence
>NC_005363, from 61369 to 61401 (33 bp); Bdellovibrio bacteriovorus HD100 GGGCTGGGGCTGGGGCTGGGGCTGGGGCTGGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 61343-61804	Sequence	Bd0067 - hypothetical protein (Protein is coded in complementary strand; from 61804 to 61343)