Sequence retrieval

Genome: Bdellovibrio bacteriovorus HD100
Start position: 3606376
End position: 3606400
Length: 25

DNA sequence
>NC_005363, from 3606376 to 3606400 (25 bp); Bdellovibrio bacteriovorus HD100 TCGCCTTCGACTTCGTCTTCGCTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3606181-3606612	Sequence	Bd3730 - hypothetical protein (Protein is coded in complementary strand; from 3606612 to 3606181)