Sequence retrieval

Genome: Bdellovibrio bacteriovorus HD100
Start position: 3597878
End position: 3597905
Length: 28

DNA sequence
>NC_005363, from 3597878 to 3597905 (28 bp); Bdellovibrio bacteriovorus HD100 TCACTGTCTTTACTGTCTTTACTGTCTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3597061-3597915	Sequence	Bd3721 - hypothetical protein (Protein is coded in complementary strand; from 3597915 to 3597061)