Sequence retrieval

Genome: Bdellovibrio bacteriovorus HD100
Start position: 2845623
End position: 2845663
Length: 41

DNA sequence
>NC_005363, from 2845623 to 2845663 (41 bp); Bdellovibrio bacteriovorus HD100 CCGTTATTTCCGTTATTTCCGTTATTTCCGTTATTTCCGTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2843298-2846453	Sequence	Bd2932 - hypothetical protein (Protein is coded in complementary strand; from 2846453 to 2843298)