Sequence retrieval

Genome: Bdellovibrio bacteriovorus HD100
Start position: 2348187
End position: 2348210
Length: 24

DNA sequence
>NC_005363, from 2348187 to 2348210 (24 bp); Bdellovibrio bacteriovorus HD100 CCCGCCCCCGCACCCGTCCCCGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2347089-2350412	Sequence	Bd2439 - cell wall surface anchor family protein (Protein is coded in complementary strand; from 2350412 to 2347089)