Sequence retrieval

Genome: Bdellovibrio bacteriovorus HD100
Start position: 2332450
End position: 2332476
Length: 27

DNA sequence
>NC_005363, from 2332450 to 2332476 (27 bp); Bdellovibrio bacteriovorus HD100 TCCGCCGCCACCGCCGCCTCCGCCGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2331635-2332540	Sequence	Bd2427 - hypothetical protein (Protein is coded in complementary strand; from 2332540 to 2331635)