Sequence retrieval

Genome: Bdellovibrio bacteriovorus HD100
Start position: 2087109
End position: 2087141
Length: 33

DNA sequence
>NC_005363, from 2087109 to 2087141 (33 bp); Bdellovibrio bacteriovorus HD100 TGGCGGTGGAGGTGGTGGTGGCGGTGGTGGTGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2087017-2087814	Sequence	Bd2187 - hypothetical protein (Protein is coded in complementary strand; from 2087814 to 2087017)