Sequence retrieval

Genome: Bdellovibrio bacteriovorus HD100
Start position: 1995972
End position: 1995998
Length: 27

DNA sequence
>NC_005363, from 1995972 to 1995998 (27 bp); Bdellovibrio bacteriovorus HD100 AGTCACCAGGGTCACCAGAATCACCAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1994650-1996890	Sequence	Bd2084 - cation:proton antiporter (Protein is coded in complementary strand; from 1996890 to 1994650)