Sequence retrieval

Genome: Bdellovibrio bacteriovorus HD100
Start position: 1733806
End position: 1733841
Length: 36

DNA sequence
>NC_005363, from 1733806 to 1733841 (36 bp); Bdellovibrio bacteriovorus HD100 CTGTTTCTTTTCCTGTTCCTTTTGCTGTTTTTCTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1733417-1735294	Sequence	Bd1806 htpG heat shock protein 90 (Protein is coded in complementary strand; from 1735294 to 1733417)