Sequence retrieval

Genome: Lactobacillus johnsonii NCC 533
Start position: 1239444
End position: 1239500
Length: 57

DNA sequence
>NC_005362, from 1239444 to 1239500 (57 bp); Lactobacillus johnsonii NCC 533 AACAGGCTTAGTTGGAGTAACTGGTTTAGATGGAGTTACTGGCTTAGCTGGAGTAAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1238782-1240311	Sequence	LJ1313 - hypothetical protein (Protein is coded in complementary strand; from 1240311 to 1238782)