Sequence retrieval

Genome: Lactobacillus johnsonii NCC 533
Start position: 1979845
End position: 1979882
Length: 38

DNA sequence
>NC_005362, from 1979845 to 1979882 (38 bp); Lactobacillus johnsonii NCC 533 TTCTTTTTATAATGCTTTTTACAATTGTTTTCATAATT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 1978287-1979879	Sequence	LJ1848 - ABC transporter ATPase component (Protein is coded in complementary strand; from 1979879 to 1978287)