Sequence retrieval

Genome: Lactobacillus johnsonii NCC 533
Start position: 1389444
End position: 1389480
Length: 37

DNA sequence
>NC_005362, from 1389444 to 1389480 (37 bp); Lactobacillus johnsonii NCC 533 CTTCTTCAGTTTCTTCTTCAGTTTCTTCTTCAGTTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1388336-1389667	Sequence	LJ1519 - signal recognition particle receptor FtsY (Protein is coded in complementary strand; from 1389667 to 1388336)