Sequence retrieval

Genome: Lactobacillus johnsonii NCC 533
Start position: 552149
End position: 552173
Length: 25

DNA sequence
>NC_005362, from 552149 to 552173 (25 bp); Lactobacillus johnsonii NCC 533 AAAATAAAAATTAAACTAAAAAAAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 550823-552205	Sequence	LJ0494 - hypothetical protein (Protein is coded in complementary strand; from 552205 to 550823)