Sequence retrieval

Genome: Lactobacillus johnsonii NCC 533
Start position: 329645
End position: 329669
Length: 25

DNA sequence
>NC_005362, from 329645 to 329669 (25 bp); Lactobacillus johnsonii NCC 533 ACTACAACTAAAACAACAACTACAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 329225-329749	Sequence	LJ0289 - Lj965 prophage superinfection immunity protein (Protein is coded in complementary strand; from 329749 to 329225)