Sequence retrieval

Genome: Lactobacillus johnsonii NCC 533
Start position: 1320230
End position: 1320254
Length: 25

DNA sequence
>NC_005362, from 1320230 to 1320254 (25 bp); Lactobacillus johnsonii NCC 533 CCTAACCTATCCTTACCTAACCTAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1319795-1320685	Sequence	LJ1448 - Lj928 prophage protein (Protein is coded in complementary strand; from 1320685 to 1319795)