Sequence retrieval

Genome: Lactobacillus johnsonii NCC 533
Start position: 1850064
End position: 1850087
Length: 24

DNA sequence
>NC_005362, from 1850064 to 1850087 (24 bp); Lactobacillus johnsonii NCC 533 TCTTTTTACTTTTTACTTTTTTCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1849205-1850983	Sequence	LJ0530 - hypothetical protein (Protein is coded in complementary strand; from 1850983 to 1849205)