Sequence retrieval

Genome: Lactobacillus johnsonii NCC 533
Start position: 1187245
End position: 1187268
Length: 24

DNA sequence
>NC_005362, from 1187245 to 1187268 (24 bp); Lactobacillus johnsonii NCC 533 TATTTTTATCTTTATTTGTATTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1185633-1187825	Sequence	LJ1261 - phosphoenolpyruvate-dependent sugar phosphotransferase system EIIABC, beta-glucoside-specific (Protein is coded in complementary strand; from 1187825 to 1185633)