Sequence retrieval

Genome: Onion yellows phytoplasma
Start position: 850306
End position: 850335
Length: 30

DNA sequence
>NC_005303, from 850306 to 850335 (30 bp); Onion yellows phytoplasma TTTTATAAAATTTTATAAATGTTTAAAAAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 850309-850425	Sequence	PAM_753 - hypothetical protein (Protein is coded in complementary strand; from 850425 to 850309)