Sequence retrieval

Genome: Onion yellows phytoplasma
Start position: 847856
End position: 847888
Length: 33

DNA sequence
>NC_005303, from 847856 to 847888 (33 bp); Onion yellows phytoplasma CCAAAAAAAGAGCAAAAACAGACAAAAAAAAGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 847087-847881	Sequence	PAM_750 ugpE sugar permease (Protein is coded in complementary strand; from 847881 to 847087)