Sequence retrieval

Genome: Onion yellows phytoplasma
Start position: 846121
End position: 846150
Length: 30

DNA sequence
>NC_005303, from 846121 to 846150 (30 bp); Onion yellows phytoplasma AAAATTTTTTAAAATCTTTAATCATTTTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 845481-847103	Sequence	PAM_749 ugpB sugar-binding periplasmic protein (Protein is coded in complementary strand; from 847103 to 845481)