Sequence retrieval

Genome: Onion yellows phytoplasma
Start position: 832837
End position: 832860
Length: 24

DNA sequence
>NC_005303, from 832837 to 832860 (24 bp); Onion yellows phytoplasma ATTAATATTGATGTTAATATTGAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 832861-835326	Sequence	PAM_738 leuS leucyl-tRNA synthetase (Protein is coded in complementary strand; from 835326 to 832861)