Sequence retrieval

Genome: Onion yellows phytoplasma
Start position: 797750
End position: 797776
Length: 27

DNA sequence
>NC_005303, from 797750 to 797776 (27 bp); Onion yellows phytoplasma TTGATTTGATTGATTTGATTGATTTGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 797190-797933	Sequence	PAM_705 grpE molecular chaperone GrpE (Protein is coded in complementary strand; from 797933 to 797190)