Sequence retrieval

Genome: Onion yellows phytoplasma
Start position: 548896
End position: 548931
Length: 36

DNA sequence
>NC_005303, from 548896 to 548931 (36 bp); Onion yellows phytoplasma GCTAAAAAATTAGCTAAAAAGTTAAGTAAAAAATTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 548612-549574	Sequence	PAM_489 artI ABC-type amino acid transport system, periplasmic component