Sequence retrieval

Genome: Onion yellows phytoplasma
Start position: 537986
End position: 538012
Length: 27

DNA sequence
>NC_005303, from 537986 to 538012 (27 bp); Onion yellows phytoplasma AGGATTTGAAGGATTTAAAGGATTTGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 537294-538157	Sequence	PAM_479 - hypothetical protein (Protein is coded in complementary strand; from 538157 to 537294)