Sequence retrieval

Genome: Onion yellows phytoplasma
Start position: 467361
End position: 467390
Length: 30

DNA sequence
>NC_005303, from 467361 to 467390 (30 bp); Onion yellows phytoplasma TTTTTTAAATTCTTTTATATTTTTTTGATT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 467350-467559	Sequence	PAM_755 - hypothetical protein (Protein is coded in complementary strand; from 467559 to 467350)