Sequence retrieval

Genome: Onion yellows phytoplasma
Start position: 440073
End position: 440096
Length: 24

DNA sequence
>NC_005303, from 440073 to 440096 (24 bp); Onion yellows phytoplasma TTGTTTTTCTTTTTGATTTTGGTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 438220-440514	Sequence	PAM_393 hflB ATP-dependent Zn protease (Protein is coded in complementary strand; from 440514 to 438220)