Sequence retrieval

Genome: Onion yellows phytoplasma
Start position: 437710
End position: 437754
Length: 45

DNA sequence
>NC_005303, from 437710 to 437754 (45 bp); Onion yellows phytoplasma TTTCTAAATCTATTTGTTCTAAATTTATTTGTTCTAAATTTTTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 437673-438128	Sequence	PAM_392 - hypothetical protein (Protein is coded in complementary strand; from 438128 to 437673)