Sequence retrieval

Genome: Onion yellows phytoplasma
Start position: 408358
End position: 408381
Length: 24

DNA sequence
>NC_005303, from 408358 to 408381 (24 bp); Onion yellows phytoplasma TTTTTTTGTTTTTTTAATTTTTTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 408337-408966	Sequence	PAM_360 fliA DNA-directed RNA polymerase specialized sigma (Protein is coded in complementary strand; from 408966 to 408337)