Sequence retrieval

Genome: Onion yellows phytoplasma
Start position: 388398
End position: 388422
Length: 25

DNA sequence
>NC_005303, from 388398 to 388422 (25 bp); Onion yellows phytoplasma TTTTTTTTCTTTTATTTTTGTTATT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 388385-390145	Sequence	PAM_342 - retron-type reverse transcriptase (Protein is coded in complementary strand; from 390145 to 388385)