Sequence retrieval

Genome: Onion yellows phytoplasma
Start position: 367465
End position: 367488
Length: 24

DNA sequence
>NC_005303, from 367465 to 367488 (24 bp); Onion yellows phytoplasma TTTTTTTGTTTTTTTAATTTTTTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 367444-368073	Sequence	PAM_320 fliA DNA-directed RNA polymerase specialized sigma (Protein is coded in complementary strand; from 368073 to 367444)