Sequence retrieval

Genome: Onion yellows phytoplasma
Start position: 183283
End position: 183309
Length: 27

DNA sequence
>NC_005303, from 183283 to 183309 (27 bp); Onion yellows phytoplasma GTTTTAATTGTTTTAATTCTTTTAATT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 181476-183935	Sequence	PAM_154 priA primosomal protein N' (Protein is coded in complementary strand; from 183935 to 181476)